View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500-INSERTION-1 (Length: 688)
Name: NF0500-INSERTION-1
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0500-INSERTION-1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 47626746 - 47626527
Alignment:
| Q |
1 |
aaaacaatgtgcaaaagaagagattcttgaaatccaaaccctaatttcttccaatgacaactccaacaaatcttcaggctactctacactccttcaattc |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47626746 |
aaaacaatgt-caaaagaagagattcttgaaatccaaaccctaatttcttccaatgacaactccaacaaatcttcaggctactctacactccttcaattc |
47626648 |
T |
|
| Q |
101 |
caacaacattcttgcattaacccttcttcccttcaatcccttgcacataattccaattccatcatttcctccaccctttcagatatcgaacaccacgacg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47626647 |
caacaacattcttgcattaacccttcttcccttcaatcccttgcacagaattccaattccatcatttcctccaccctttctgatatcgaacaccacgacg |
47626548 |
T |
|
| Q |
201 |
aggaaatgtaagcatccaaga |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47626547 |
aggaaatgtaagcatccaaga |
47626527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 288 - 512
Target Start/End: Complemental strand, 47626456 - 47626232
Alignment:
| Q |
288 |
gtttgttagagctgcacaaggcttgaaatgtttgggattcatgatttatcatccctccattgtttctgagcttcgaggtaacaattttctctattttctt |
387 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47626456 |
gtttgttagagctgcacaagccttgaaatgtttgggattcatgatttatcatccctccattgtttctgagcttcgaggtaacaattttcgctattttctt |
47626357 |
T |
|
| Q |
388 |
aactttgtgattcgattttatgcaatgcttannnnnnnnnnattgttttgcagtggatgatgttaatttggtgttggattcattagccaaactaattaca |
487 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47626356 |
aactttgtgattcgattttatgcaatgcttattttttttatattgttttgcagtggatgatgttaatttggtgttggattcattagccaaactaattaca |
47626257 |
T |
|
| Q |
488 |
accacaaaattgaaggttcagtagg |
512 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
47626256 |
accacaaaattgaaggttcagtagg |
47626232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 103; E-Value: 7e-51
Query Start/End: Original strand, 583 - 685
Target Start/End: Complemental strand, 47626162 - 47626060
Alignment:
| Q |
583 |
atactattgttgcagactgtttgtaatttaggggtgtggtgcttttctgtacaacagttaggtgtatcgtttcttgttgctcactttcactctttgttac |
682 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47626162 |
atactattgttgcagactgtttgtaatttaggggtgtggtgcttttctgtacaacagttaggtgtatcgtttcttgttgctcactttcactctttgttac |
47626063 |
T |
|
| Q |
683 |
gag |
685 |
Q |
| |
|
||| |
|
|
| T |
47626062 |
gag |
47626060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1331 times since January 2019
Visitors: 3441