View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500-INSERTION-15 (Length: 169)
Name: NF0500-INSERTION-15
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0500-INSERTION-15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 18694838 - 18694735
Alignment:
| Q |
1 |
tcttgtttgttcttatagatcacttttatcatatgttgtttggtgggttg-aatttgaaaagttttgannnnnnnaggaaaaaataaaagtaattatact |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18694838 |
tcttgtttgttcttatagatcacttttatcatatgttgtttggtgagttgaaatttgaaaagttttgatttttttaggaaaaaataaaagtaattatact |
18694739 |
T |
|
| Q |
100 |
tttc |
103 |
Q |
| |
|
|||| |
|
|
| T |
18694738 |
tttc |
18694735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1537 times since January 2019
Visitors: 3457