View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500-INSERTION-30 (Length: 220)
Name: NF0500-INSERTION-30
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0500-INSERTION-30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 61 - 213
Target Start/End: Original strand, 6205189 - 6205341
Alignment:
| Q |
61 |
aagttatgtttctttgccaataaaaacacaattgtccttttctcatcttaaggccttttctaaagcattggttgagagaattgtctatgtataagaaaca |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6205189 |
aagttatgtttctttgccaataaaaacacaattgtccttttctcatcttaaggccttttctaaagcattggttgagagaattgtctatatataagaaaca |
6205288 |
T |
 |
| Q |
161 |
ctctctcactttacttatttcaagagttgaggtagtcattttgatattagagt |
213 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6205289 |
ctctctcactttagttatttcaagagttgaggtagtcattttgatattagagt |
6205341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University