View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500-INSERTION-32 (Length: 367)
Name: NF0500-INSERTION-32
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0500-INSERTION-32 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 367
Target Start/End: Complemental strand, 3854774 - 3854408
Alignment:
| Q |
1 |
cctctacccatttcccttaaaatgaaattctatgtctaacactctttaagtcaaaagataaactttggattgtaagtcgggaaagtattatgttcaggaa |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3854774 |
cctctacccatttcccttataatgaaattatatgtctaacactccttaagtcaaaagataaattttgaattgtaagtcgggaaagtattatgttcaggaa |
3854675 |
T |
 |
| Q |
101 |
ttgaaacacatgtaaagattcctctgttagctcccacgcacctacacatgcaaagatcaaacacgaatgtgaagtggcaaaggccaaaattaggttttgt |
200 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3854674 |
ttgaaacacatgcaaagattcctctattagctcccacgcacctacacatgcaaagatcaaacacgaatgtgaagtggcaaaggccaaaattaggttttgt |
3854575 |
T |
 |
| Q |
201 |
taaaatcagtacaaatgtaaatttatctgaggtgggtatttggggattaggtgttgttgctcgtgatgacaatggtgaagagttgggatcttctacttgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3854574 |
taaaatcagtacaaatgtaaatttatctgaggtgggtatttggggattaggtgttgttgctcgtgatgacaatggtgaagagttgggatcttctacttgg |
3854475 |
T |
 |
| Q |
301 |
tgtgtcgaaggttttgaagaccgagccactgcggaagctttcctcatgtttaaagctttgtgttggg |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3854474 |
tgtgtcgaaggttttgaagaccgagccactgcggaagctttcctcatgtttaaagctttgtgttggg |
3854408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University