View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0500-INSERTION-33 (Length: 69)

Name: NF0500-INSERTION-33
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0500-INSERTION-33
NF0500-INSERTION-33
[»] chr8 (1 HSPs)
chr8 (28-69)||(43867545-43867586)


Alignment Details
Target: chr8 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 69
Target Start/End: Complemental strand, 43867586 - 43867545
Alignment:
28 aattggtatgatcttagtgttgattggctagagagttgaagt 69  Q
    ||||||||||||||||||||||||||||||||||||||||||    
43867586 aattggtatgatcttagtgttgattggctagagagttgaagt 43867545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University