View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500-INSERTION-33 (Length: 69)
Name: NF0500-INSERTION-33
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0500-INSERTION-33 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 69
Target Start/End: Complemental strand, 43867586 - 43867545
Alignment:
Q |
28 |
aattggtatgatcttagtgttgattggctagagagttgaagt |
69 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43867586 |
aattggtatgatcttagtgttgattggctagagagttgaagt |
43867545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University