View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500_high_20 (Length: 258)
Name: NF0500_high_20
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0500_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 15817081 - 15817310
Alignment:
| Q |
1 |
ctagtcttatcctttgggaatctcatattccttgtcctttctagtattgctaaccattggtgattcatggagcttcgtttgcaagtatcactattgatag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
15817081 |
ctagtcttatcctttgggaatctcatattccttatcctttccagtattgctaaccattggtgattcatggagcttcgtttgcaagtatcactattgatgg |
15817180 |
T |
 |
| Q |
101 |
acccacgttttacaattgtactaggtaccgg-ttatcataccgcaacttcaaatttaatttaaataccatgccaatattttttgtcattctatctccaca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15817181 |
acccacgttttacaattgtactaggtaccggtttatcatactgcaacttcaaatttaatttaaataccatgccaatattttttgtcattctatctccaca |
15817280 |
T |
 |
| Q |
200 |
atcaataatagcaaacatatatgtctgtgg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15817281 |
atcaataatagcaaacatatatgtctgtgg |
15817310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University