View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500_high_26 (Length: 214)
Name: NF0500_high_26
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0500_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 3 - 108
Target Start/End: Complemental strand, 49971939 - 49971834
Alignment:
| Q |
3 |
gccgtcacaatcattctcttcttctcgcaactcattctcaatttcgatgaaaatcataaaggnnnnnnnttatgcagggcacattgggaggacccagata |
102 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49971939 |
gccgtcacaatcatcctcttcttctcgcaactcattctcaatttcgatgaaaatcataaaggaaaaaaattatgcagggcacattgggaggacccagata |
49971840 |
T |
 |
| Q |
103 |
ttgttc |
108 |
Q |
| |
|
|||||| |
|
|
| T |
49971839 |
ttgttc |
49971834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University