View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500_low_16 (Length: 342)
Name: NF0500_low_16
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0500_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 4e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 75 - 237
Target Start/End: Original strand, 18694677 - 18694840
Alignment:
| Q |
75 |
ttttcctatgcatcaaaaagattacaattccttgatagcatgacaattgacaacacaagaaaagtataattacttttattttttcctnnnnnnntcaaaa |
174 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18694677 |
ttttcctatgcatcaaaaaccttacaattccttgatagcatgacaattgacaacacaagaaaagtataattacttttattttttcctaaaaaaatcaaaa |
18694776 |
T |
 |
| Q |
175 |
cttttcaaa-ttcaacccaccaaacaacatatgataaaagtgatctataagaacaaacaagacc |
237 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18694777 |
cttttcaaatttcaactcaccaaacaacatatgataaaagtgatctataagaacaaacaagacc |
18694840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University