View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500_low_17 (Length: 341)
Name: NF0500_low_17
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0500_low_17 |
 |  |
|
[»] scaffold0543 (1 HSPs) |
 |  |  |
|
[»] scaffold0492 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 7e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 3 - 176
Target Start/End: Complemental strand, 49971939 - 49971766
Alignment:
Q |
3 |
gccgtcacaatcattctcttcttctcgcaactcattctcaatttcgatgaaaatcataaaggnnnnnnnttatgcagggcacattgggaggacccagata |
102 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
49971939 |
gccgtcacaatcatcctcttcttctcgcaactcattctcaatttcgatgaaaatcataaaggaaaaaaattatgcagggcacattgggaggacccagata |
49971840 |
T |
 |
Q |
103 |
ttgttccggaatgtcttttatagcatcttacaaagtgttcacttaaaattgacagcagtctaagttggaagttt |
176 |
Q |
|
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49971839 |
ttgttccgaaatgtcttttatcgcatcttacaaagtgttcacttaaaattgacagcagtctaagttggaagttt |
49971766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 199 - 301
Target Start/End: Complemental strand, 49971695 - 49971593
Alignment:
Q |
199 |
tagatacagatgcaaaagaacaaatgttcatggaattatctttgtgcgcaaggaattcaacagtgtgtcaacttttatttatttgaatactgccacaggt |
298 |
Q |
|
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
49971695 |
tagatacagatgcaaaacaccaaatgttcatggaattatctttgtgcgcaaggaattcggcagtgtgtcaacttttatttatttgcatactgccacaggt |
49971596 |
T |
 |
Q |
299 |
tct |
301 |
Q |
|
|
||| |
|
|
T |
49971595 |
tct |
49971593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0543 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0543
Description:
Target: scaffold0543; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 219 - 286
Target Start/End: Complemental strand, 2066 - 1999
Alignment:
Q |
219 |
caaatgttcatggaattatctttgtgcgcaaggaattcaacagtgtgtcaacttttatttatttgaat |
286 |
Q |
|
|
||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
T |
2066 |
caaatgttcatggaattatatttgtgcccaaggaattcaatcacatgtcaacttttatttatttgaat |
1999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0492 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0492
Description:
Target: scaffold0492; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 219 - 286
Target Start/End: Complemental strand, 3612 - 3545
Alignment:
Q |
219 |
caaatgttcatggaattatctttgtgcgcaaggaattcaacagtgtgtcaacttttatttatttgaat |
286 |
Q |
|
|
||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
T |
3612 |
caaatgttcatggaattatatttgtgcccaaggaattcaatcacatgtcaacttttatttatttgaat |
3545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University