View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500_low_25 (Length: 276)
Name: NF0500_low_25
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0500_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 40 - 219
Target Start/End: Original strand, 48957696 - 48957876
Alignment:
| Q |
40 |
gaggttaatgtcacattgacataaaaataggggaggttagtgtgtacttaaaaattagagggagtgtttgtgctattttgaaagatctcaggggaggtca |
139 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48957696 |
gaggttaatgtcacattgagataaaaataagggaggttagtgtgtacttaaaaattagagggagtgtttgtgctattttgaaagatctcaggggaggtca |
48957795 |
T |
 |
| Q |
140 |
atgtaatagaaagtacttggggtaaagcaatg-ttgtcaaatagtagtagctatagcgtagcagaattttaaccaactgtt |
219 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48957796 |
atgtaatagaaagtacttagggtaaagcaatgtttgtcaaatagtagtagctatagcgtagcagaattttaaccaactgtt |
48957876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 67 - 146
Target Start/End: Original strand, 34597644 - 34597723
Alignment:
| Q |
67 |
taggggaggttagtgtgtacttaaaaattagagggagtgtttgtgctattttgaaagatctcaggggaggtcaatgtaat |
146 |
Q |
| |
|
||||||||| |||||| || || |||||||||||| |||||||| ||||| ||| ||||||||||||||||||||| |
|
|
| T |
34597644 |
taggggaggctagtgtttattttaaaattagaggggatgtttgtgttatttaaggagacctcaggggaggtcaatgtaat |
34597723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University