View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500_low_26 (Length: 263)
Name: NF0500_low_26
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0500_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 23 - 255
Target Start/End: Original strand, 38679507 - 38679731
Alignment:
Q |
23 |
cacagatacagtttgttgacgaatatcgttacacactgcatcatttcttgctgcccataacttccaaagaagcattatgtagtattagacaaaggaaaga |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
38679507 |
cacagatacagtttgttgacgaatatcgttacacactgcatcatttcttgctgcccataacttccaaagaagcattatgtagcattagacaaaggaaaga |
38679606 |
T |
 |
Q |
123 |
ggaatgcaatttgcaaaacaatagtcgcgcatatgacaatcaatgtagttgtgcaaaattaagtacttgtttggtttggcgtttgaagaagagttttcca |
222 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
T |
38679607 |
ggaatgcaatttgcaaaacaatagtcgcgcatatgacaatcaatgtagttgtgcaaaattaagttc--------tttggcgtttgaagaagagttttcca |
38679698 |
T |
 |
Q |
223 |
tgtcacacttatctactatttgaagtgcttttt |
255 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
38679699 |
tgtcacacttatctactatttgaagtgcttttt |
38679731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University