View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500_low_29 (Length: 252)
Name: NF0500_low_29
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0500_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 38568992 - 38568829
Alignment:
Q |
1 |
ttctctttttgtcgtagtctagcgtggtaaatcagggagtgtcgtgtccgaacacctgcatatcaacatctttgcagctataccaaacgagctgtactta |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38568992 |
ttctctttttgtcgtagtctagcgtggtaaatcggggagtgtcgtgtccgaacacctgcatatcaacatctttgcagctataccaaacgagctgtactta |
38568893 |
T |
 |
Q |
101 |
tgggatgaatgagatttttctttaatttgtagaataaattttcagttacatgatgatgatgatg |
164 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38568892 |
tgggatgaatgagatttttctttaatttgtagaataaattttcagttacatgatgatgatgatg |
38568829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University