View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0500_low_29 (Length: 252)

Name: NF0500_low_29
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0500_low_29
NF0500_low_29
[»] chr1 (1 HSPs)
chr1 (1-164)||(38568829-38568992)


Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 38568992 - 38568829
Alignment:
1 ttctctttttgtcgtagtctagcgtggtaaatcagggagtgtcgtgtccgaacacctgcatatcaacatctttgcagctataccaaacgagctgtactta 100  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38568992 ttctctttttgtcgtagtctagcgtggtaaatcggggagtgtcgtgtccgaacacctgcatatcaacatctttgcagctataccaaacgagctgtactta 38568893  T
101 tgggatgaatgagatttttctttaatttgtagaataaattttcagttacatgatgatgatgatg 164  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38568892 tgggatgaatgagatttttctttaatttgtagaataaattttcagttacatgatgatgatgatg 38568829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University