View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500_low_31 (Length: 250)
Name: NF0500_low_31
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0500_low_31 |
 |  |
|
| [»] scaffold0653 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 5 - 235
Target Start/End: Original strand, 9248606 - 9248855
Alignment:
| Q |
5 |
ttaacattatgcacttttaagccattttatatttactaaagctaaatttaagaaacatgtaaatttcaaggtgccaagaaaac----------------- |
87 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
9248606 |
ttaaaattatgcacttttaagccattttatatttactaaagctaaatttaagaaacatgtaaatttctgggtgccaacaaaacacactctctctccctcc |
9248705 |
T |
 |
| Q |
88 |
-tctctctcactccatttaaatcaaaaccaattatatacgatgtagatggatggttggtggtagtgctctcaggcccttaaggccaaccaccaactga-c |
185 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| | |||| |||||||||||||| |||||||||||||||| ||||||||| | |
|
|
| T |
9248706 |
ctctctctctctccatttaaatcaaaaccaattatatacgatgtagatccaaggttagtggtagtgctctcgggcccttaaggccaacaaccaactgacc |
9248805 |
T |
 |
| Q |
186 |
gtcatcagtgccattgggatactttcagtcacacgctaccttcgtctgtg |
235 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| |||||||| |||| |
|
|
| T |
9248806 |
gtcattagtgccattgggatattttcagtcacacgccaccttcgtttgtg |
9248855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 90 - 235
Target Start/End: Original strand, 9244493 - 9244639
Alignment:
| Q |
90 |
tctctcactccatttaaatcaaaaccaattatatacgatgtagatggatggttggtggtagtgctctcaggcccttaaggccaaccaccaactga-cgtc |
188 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||| || | |||| ||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
9244493 |
tctctctctccatttaaatgaaaaccaattatatacgatgtatatccaaggttattggtagtgctctcgggcccttaaggccaaccaccaactgaccgtc |
9244592 |
T |
 |
| Q |
189 |
atcagtgccattgggatactttcagtcacacgctaccttcgtctgtg |
235 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
9244593 |
attagtgccattgggatactttcagtcacacgccaccttcgtttgtg |
9244639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0653 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: scaffold0653
Description:
Target: scaffold0653; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 90 - 235
Target Start/End: Complemental strand, 5268 - 5122
Alignment:
| Q |
90 |
tctctcactccatttaaatcaaaaccaattatatacgatgtagatggatggttggtggtagtgctctcaggcccttaaggccaaccaccaactga-cgtc |
188 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||| || | |||| ||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
5268 |
tctctctctccatttaaatgaaaaccaattatatacgatgtatatccaaggttattggtagtgctctcgggcccttaaggccaaccaccaactgaccgtc |
5169 |
T |
 |
| Q |
189 |
atcagtgccattgggatactttcagtcacacgctaccttcgtctgtg |
235 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
5168 |
attagtgccattgggatactttcagtcacacgccaccttcgtttgtg |
5122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University