View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500_low_35 (Length: 226)
Name: NF0500_low_35
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0500_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 3 - 151
Target Start/End: Complemental strand, 49971939 - 49971791
Alignment:
Q |
3 |
gccgtcacaatcattctcttcttctcgcaactcattctcaatttcgatgaaaatcataaaggnnnnnnnttatgcagggcacattgggaggacccagata |
102 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
49971939 |
gccgtcacaatcatcctcttcttctcgcaactcattctcaatttcgatgaaaatcataaaggaaaaaaattatgcagggcacattgggaggacccagata |
49971840 |
T |
 |
Q |
103 |
ttgttccggaatgtcttttatagcatcttacaaagtgttcacttaaaat |
151 |
Q |
|
|
|||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
49971839 |
ttgttccgaaatgtcttttatcgcatcttacaaagtgttcacttaaaat |
49971791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 143 - 215
Target Start/End: Original strand, 23528920 - 23528992
Alignment:
Q |
143 |
acttaaaataaggctgaattattgcattgcaatcacattattgaccattttgtttccgttttgtgcaacagct |
215 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
23528920 |
acttaaaataaggctgaattattgcattgcaatcacattattgaccattttgtttccgttttgtgtaacagct |
23528992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University