View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500_low_37 (Length: 208)
Name: NF0500_low_37
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0500_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 24 - 164
Target Start/End: Complemental strand, 34122664 - 34122524
Alignment:
| Q |
24 |
atatttctcctgttataaaaataaaatgaatttttcaatcaaccaaaaatatgttaccctaagaatgacactatacattgatggacattgttgttattgt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34122664 |
atatttctcctgttataaaaataaaatgaatttttcaatcaaccaaaaatatgttaccctaagaatgacactatacattgatggacattgttgttattgt |
34122565 |
T |
 |
| Q |
124 |
tcatctattgatgattcttattacaacatctttcccatata |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34122564 |
tcatctattgatgattcttattacaacatctttcccatata |
34122524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University