View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0500_low_4 (Length: 516)
Name: NF0500_low_4
Description: NF0500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0500_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 77 - 422
Target Start/End: Original strand, 49475744 - 49476085
Alignment:
| Q |
77 |
acagaaaagaaaacaaaacataagaacactgttacagtgacaatttgcaaatttgtacttttgcagctgatcttcatggtatctgatagactcgcaataa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49475744 |
acagaaaagaaaacaaaacataagaacactgttacggtgacaatttgcaaatttgtacttttgcagctgatcttcatggtatctgatagactcgcaataa |
49475843 |
T |
|
| Q |
177 |
taaagagaaaaggaaggaactaacggcaacttgtaaataaactgtagataaattaggagttagttgagaactaagtgaggactgtagaggtgcgtgggtt |
276 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49475844 |
taaagaaaaaaggaaggaactaacggcaacttgtaaataaactgtagataaattaggagttagttgagaactaagtgaggactgtagag----atgggtt |
49475939 |
T |
|
| Q |
277 |
ctcctaaaaatcaccttacactgtattctccctggttgcattgaccaaagactacaaaataacaatttaggtgcctacgtccaaagaatacaagcaatgg |
376 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
49475940 |
ctcctaaaaatcacctcacactgtattctccctggttgcattgaccaaagactacaaaataacaatttaggtgcctatgtccaaagaatacaagcaatag |
49476039 |
T |
|
| Q |
377 |
tgttcattgtccttagatgtacatgggcaactaatgttgccggaac |
422 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49476040 |
tgttcattgtgcttagatgtacatgggcaactaatgttgccggaac |
49476085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1277 times since January 2019
Visitors: 3440