View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0501-INSERTION-2 (Length: 179)
Name: NF0501-INSERTION-2
Description: NF0501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0501-INSERTION-2 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0003 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 7 - 173
Target Start/End: Complemental strand, 337530 - 337364
Alignment:
| Q |
7 |
aggaactgattccaatgggtcccactattttcaaccttaatactaataaaggaaaaaatgaatattaaggaaacttttatcaaccttatagtccccaaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
337530 |
aggaactgattccaatgggtcccactattttcaaccttaatactaataaaggaaaaaatgaatattaaggaaacttttatcaaccttatagtccccaaaa |
337431 |
T |
|
| Q |
107 |
aagaaaagtattcataacgctactactgtccttctacaaattaggtaacaggctattagtaaaagta |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
337430 |
aagaaaagtattcataacgctactactgtccttctacaaattaggtaacaggctattactaaaagta |
337364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1278 times since January 2019
Visitors: 3440