View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0501-INSERTION-3 (Length: 276)
Name: NF0501-INSERTION-3
Description: NF0501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0501-INSERTION-3 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 10 - 276
Target Start/End: Complemental strand, 42666310 - 42666044
Alignment:
| Q |
10 |
tccaaaattttccatacctctaagttaaagccaaggtttttgggatgataaatggtgattaaaaatgtattggcatttgctcttggggtgccaagatggt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42666310 |
tccaaaattttccatacctctaagttaaaggcaaggtttttgggatgataaatggtgattaaaaatttattggcatttgctcttggggtgccaagatggt |
42666211 |
T |
|
| Q |
110 |
gttcagtgtttgagattatggctttgttgatgnnnnnnnnnnnnncatgtttaggagcatctcagcaaggatcaaatggaaatgtttgtgatgataattt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42666210 |
gttcagtgtttgagattatggctttgttgatgttttttctctcttcatgtttaggagcatctcagcaaggatcaaatggaaatgtttgtgatgataattt |
42666111 |
T |
|
| Q |
210 |
gaggcatttgatagaagtttttggtgtaatgaatgttctttgattgtgactcaaactacctagttcc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42666110 |
gaggcatttgatagaagtttttggtgtaatgtatgttctttgattgtgactcaaactacctagttcc |
42666044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1235 times since January 2019
Visitors: 3439