View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0501_low_1 (Length: 357)
Name: NF0501_low_1
Description: NF0501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0501_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 5e-47; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 11 - 122
Target Start/End: Complemental strand, 21832908 - 21832797
Alignment:
| Q |
11 |
gcagaacctgtgaacacaaaaagacggtaacgttggtgcaaaaatggtgctggcggtgacacaaaaatattaggggttggagttaggttatgtttttatt |
110 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21832908 |
gcagaaaccgtgaacacaaaaagacggtaacgttagtgcaaaaatggtgctggcggtgacacaaaaatattagggtttggagttaggttatgtttttatt |
21832809 |
T |
 |
| Q |
111 |
gttacgggtttg |
122 |
Q |
| |
|
|||||||||||| |
|
|
| T |
21832808 |
gttacgggtttg |
21832797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 128 - 223
Target Start/End: Complemental strand, 21832497 - 21832402
Alignment:
| Q |
128 |
ggtaacggatggtgaaacaaatgttagggtttgtagttaggttatggttgtactgttgcgttactgaatgatccttggagttaggttatatttacg |
223 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21832497 |
ggtaacagatggtgaaacaaatgttagggtttgtagttaggttatggttgtactgttgcgttactgaatgatccttggagttaggttatatttacg |
21832402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 280 - 342
Target Start/End: Complemental strand, 21832347 - 21832285
Alignment:
| Q |
280 |
acataaaattcaacttcattcaattaggaaatggattatcggcaacacttatttctccacact |
342 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21832347 |
acataaaattcaacttcattcaattgggaaatggattatcggcaacacttatttctccacact |
21832285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University