View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0502_high_10 (Length: 209)
Name: NF0502_high_10
Description: NF0502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0502_high_10 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 81 - 209
Target Start/End: Complemental strand, 21193627 - 21193499
Alignment:
| Q |
81 |
atactactaacaatactaacatggacagtttcaaaagagaagnnnnnnnngtaccgcggtcttgacgagctcgtcggcataggaaccagctctaatggta |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21193627 |
atactactaacaatactaacatggacagtttcaaaagagaagaaaaaaaagtaccgcggtcttgacgagctcgtcggcataggaaccagctctaatggta |
21193528 |
T |
 |
| Q |
181 |
agacctgatggagcagtagggttgcatct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21193527 |
agacctgatggagcagtagggttgcatct |
21193499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 81 - 209
Target Start/End: Complemental strand, 27249400 - 27249272
Alignment:
| Q |
81 |
atactactaacaatactaacatggacagtttcaaaagagaagnnnnnnnngtaccgcggtcttgacgagctcgtcggcataggaaccagctctaatggta |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27249400 |
atactactaacaatactaacatggacagtttcaaaagagaagaaaaaaaagtaccgcggtcttgacgagctcgtcggcataggaaccagctctaatggta |
27249301 |
T |
 |
| Q |
181 |
agacctgatggagcagtagggttgcatct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27249300 |
agacctgatggagcagtagggttgcatct |
27249272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 132 - 208
Target Start/End: Complemental strand, 27261231 - 27261155
Alignment:
| Q |
132 |
taccgcggtcttgacgagctcgtcggcataggaaccagctctaatggtaagacctgatggagcagtagggttgcatc |
208 |
Q |
| |
|
|||||||||||| |||||||| | |||||||||||||||||| || || |||| ||||||||| | |||||||||| |
|
|
| T |
27261231 |
taccgcggtcttaacgagctcattggcataggaaccagctctgatagtgagacttgatggagcggcggggttgcatc |
27261155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University