View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0502_high_3 (Length: 313)
Name: NF0502_high_3
Description: NF0502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0502_high_3 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 47 - 313
Target Start/End: Original strand, 47624806 - 47625072
Alignment:
Q |
47 |
catgcttgaacagcctgaatcttcgtaccactatctagcaaatccttcatcccattgagtaattttatcttcatatctttgacaagaacctgttgaaaaa |
146 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47624806 |
catgcttgaacagcctgaatcttcgtaccactatctagcaaatccttcatcccattgagcaattttatcttcatatctttgacaagaacctgttgaaaaa |
47624905 |
T |
 |
Q |
147 |
ggagaccagagagcacatgtataaaccattgcatgaaactttatagtacagttatgaaatgtcatggtcatgacatagtttgttttgttttccacattgc |
246 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47624906 |
ggagaccagagagcacatgtataaaccattgcatgaaactttatagtacagttatgaaatgtcatggtcatgacatagtttgttttgttttccacattgc |
47625005 |
T |
 |
Q |
247 |
aataccccaaaaaacgatatttagatcattgtctaccacagcaaaacttgcaggcagcagagttaac |
313 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47625006 |
aataccccaaaaaacgatatttagatcattgtctaccacagcaaaacttgcaggcagcagagttaac |
47625072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University