View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0502_high_5 (Length: 254)
Name: NF0502_high_5
Description: NF0502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0502_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 11 - 233
Target Start/End: Complemental strand, 33676381 - 33676159
Alignment:
| Q |
11 |
ccctagctgttgcacggatctggattaaatcagatttgttgtttaacatgacagacttggatggggggaagtactgcttaaattgatcattttgtttcgg |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33676381 |
ccctatctgttgcacggatctggattaaatcagatttgttgtttaacatgacagacttggatggggggaagtactgcttaaattgatcattttgtttcgg |
33676282 |
T |
|
| Q |
111 |
cacattccctcttccaatagacggtaactgagcatcatagttgaacatttccttgggttgatcagcatttccatggacgaactccgcagtcaacagattg |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33676281 |
cacattccctcttccaataggcggtaactgagcatcatagttgaacatttccttgggttgatcagcattcccatggacgaactccgcagtcaacagattg |
33676182 |
T |
|
| Q |
211 |
tcattaaattttggctggcacag |
233 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33676181 |
tcattaaattttggctggcacag |
33676159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1267 times since January 2019
Visitors: 3440