View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0502_high_7 (Length: 242)

Name: NF0502_high_7
Description: NF0502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0502_high_7
NF0502_high_7
[»] chr4 (1 HSPs)
chr4 (82-242)||(47624912-47625072)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 82 - 242
Target Start/End: Original strand, 47624912 - 47625072
Alignment:
82 cagagagcacatgtataaaccattgcatgaaactttatagtacagttatgaaatgtcatggtcatgacatagtttgttttgttttccacattgcaatacc 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47624912 cagagagcacatgtataaaccattgcatgaaactttatagtacagttatgaaatgtcatggtcatgacatagtttgttttgttttccacattgcaatacc 47625011  T
182 ccaaaaaacgatatttagatcattgtctaccacagcaaaacttgcaggcagcagagttaac 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47625012 ccaaaaaacgatatttagatcattgtctaccacagcaaaacttgcaggcagcagagttaac 47625072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1466 times since January 2019
Visitors: 3451