View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0502_high_9 (Length: 235)
Name: NF0502_high_9
Description: NF0502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0502_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 47625026 - 47624806
Alignment:
Q |
1 |
aatatcgttgtttggggtattgcaatgttgaaaacaaaacaaactatgtcattgccatgacatttcatatctttactataaagtttcatgtaatggttta |
100 |
Q |
|
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| || ||||||||||||||||| ||||||||| |
|
|
T |
47625026 |
aatatcgttttttggggtattgcaatgtggaaaacaaaacaaactatgtcatgaccatgacatttcataactgtactataaagtttcatgcaatggttta |
47624927 |
T |
 |
Q |
101 |
tacatgtgctctctggtctcctttttcaacaggttcttgtcaaagatatgaagataaaattactcaatgggatgaaggatttgctagatagtggtacgaa |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
47624926 |
tacatgtgctctctggtctcctttttcaacaggttcttgtcaaagatatgaagataaaattgctcaatgggatgaaggatttgctagatagtggtacgaa |
47624827 |
T |
 |
Q |
201 |
gattcaggctgttcaagcatg |
221 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
47624826 |
gattcaggctgttcaagcatg |
47624806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1547 times since January 2019
Visitors: 3457