View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0502_low_16 (Length: 242)
Name: NF0502_low_16
Description: NF0502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0502_low_16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 82 - 242
Target Start/End: Original strand, 47624912 - 47625072
Alignment:
| Q |
82 |
cagagagcacatgtataaaccattgcatgaaactttatagtacagttatgaaatgtcatggtcatgacatagtttgttttgttttccacattgcaatacc |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624912 |
cagagagcacatgtataaaccattgcatgaaactttatagtacagttatgaaatgtcatggtcatgacatagtttgttttgttttccacattgcaatacc |
47625011 |
T |
|
| Q |
182 |
ccaaaaaacgatatttagatcattgtctaccacagcaaaacttgcaggcagcagagttaac |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47625012 |
ccaaaaaacgatatttagatcattgtctaccacagcaaaacttgcaggcagcagagttaac |
47625072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1582 times since January 2019
Visitors: 3458