View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0502_low_18 (Length: 235)

Name: NF0502_low_18
Description: NF0502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0502_low_18
NF0502_low_18
[»] chr4 (1 HSPs)
chr4 (1-221)||(47624806-47625026)


Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 47625026 - 47624806
Alignment:
1 aatatcgttgtttggggtattgcaatgttgaaaacaaaacaaactatgtcattgccatgacatttcatatctttactataaagtttcatgtaatggttta 100  Q
    ||||||||| |||||||||||||||||| |||||||||||||||||||||||  ||||||||||||||| || ||||||||||||||||| |||||||||    
47625026 aatatcgttttttggggtattgcaatgtggaaaacaaaacaaactatgtcatgaccatgacatttcataactgtactataaagtttcatgcaatggttta 47624927  T
101 tacatgtgctctctggtctcctttttcaacaggttcttgtcaaagatatgaagataaaattactcaatgggatgaaggatttgctagatagtggtacgaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
47624926 tacatgtgctctctggtctcctttttcaacaggttcttgtcaaagatatgaagataaaattgctcaatgggatgaaggatttgctagatagtggtacgaa 47624827  T
201 gattcaggctgttcaagcatg 221  Q
    |||||||||||||||||||||    
47624826 gattcaggctgttcaagcatg 47624806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 77 times since January 2019
Visitors: 3464