View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0502_low_3 (Length: 425)
Name: NF0502_low_3
Description: NF0502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0502_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 207 - 388
Target Start/End: Original strand, 41530960 - 41531141
Alignment:
| Q |
207 |
cggtacattcaaaatcagcattaatcaatttgaaacatgacaatgcaggttaaatgataagctgtgatgggacnnnnnnnnttatgtccaagaattttga |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
41530960 |
cggtacattcaaaatcagcattaatcaatttgaaacatgacaatgcaggttaaatgataagctgtgataggacaaaaaaaattatgtccaagaattttga |
41531059 |
T |
 |
| Q |
307 |
tggagtttgtgcttacaagtgtaggcttggaaaatatatgccttccacaccattgcagagaacattgaccttatttgaaagc |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41531060 |
tggagtttgtgcttacaagtgtaggcttggaaaatatatgccttccacaccattgcagagaacattgaccttatttgaaagc |
41531141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 14 - 87
Target Start/End: Original strand, 41530767 - 41530840
Alignment:
| Q |
14 |
gaacctgtgtgtcgttcccattcgctaagcgcttgcttttctgtcccacaaaatccacacttgcacacaactct |
87 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41530767 |
gaacctgtgtgtcgttcccattcactaagcgcttgcttttctgtcccacaaaaaccacacttgcacacaactct |
41530840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 299 - 383
Target Start/End: Complemental strand, 15626219 - 15626135
Alignment:
| Q |
299 |
aattttgatggagtttgtgcttacaagtgtaggcttggaaaatatatgccttccacaccattgcagagaacattgaccttatttg |
383 |
Q |
| |
|
|||||||| |||||| |||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||| |||| |
|
|
| T |
15626219 |
aattttgaatgagtttatgcttacaagtgaaggcttggaaaatatatgccttccacactattgcagagaacagtgaccttctttg |
15626135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 3e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 308 - 388
Target Start/End: Complemental strand, 816656 - 816576
Alignment:
| Q |
308 |
ggagtttgtgcttacaagtgtaggcttggaaaatatatgccttccacaccattgcagagaacattgaccttatttgaaagc |
388 |
Q |
| |
|
||||||| |||||||||||| || | ||||||||||||||||||||||||||||||||||||| ||||||| |||| |||| |
|
|
| T |
816656 |
ggagtttatgcttacaagtgaagacatggaaaatatatgccttccacaccattgcagagaacagtgaccttctttggaagc |
816576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 14 - 87
Target Start/End: Complemental strand, 817448 - 817375
Alignment:
| Q |
14 |
gaacctgtgtgtcgttcccattcgctaagcgcttgcttttctgtcccacaaaatccacacttgcacacaactct |
87 |
Q |
| |
|
||||||||||| ||||||||||| ||||| || || ||||| ||||||||||| |||||||||||| |||||| |
|
|
| T |
817448 |
gaacctgtgtggcgttcccattcactaagtgcctgtttttcagtcccacaaaaatcacacttgcacataactct |
817375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University