View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0502_low_6 (Length: 325)
Name: NF0502_low_6
Description: NF0502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0502_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 1 - 297
Target Start/End: Complemental strand, 47624976 - 47624680
Alignment:
| Q |
1 |
atgaccatgacatttcataactgtactataaagtttcatgcaatggtttatacatgtgctctctggtctcctttttcaacaggttcttgtcaaagatatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624976 |
atgaccatgacatttcataactgtactataaagtttcatgcaatggtttatacatgtgctctctggtctcctttttcaacaggttcttgtcaaagatatg |
47624877 |
T |
|
| Q |
101 |
aagataaaattactcaatgggatgaaggatttgctagatagtggtacgaagattcaggctgttcaagcatggggatggtttattcgaatgctcgggtccc |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624876 |
aagataaaattgctcaatgggatgaaggatttgctagatagtggtacgaagattcaggctgttcaagcatggggatggtttattcgaatgctcgggtccc |
47624777 |
T |
|
| Q |
201 |
atgctttgaaaaacaagcatttagttaatgatatgttgaaaatacctgagcgtacatttacagatcctgaccctcaagttcagattgccacacaggt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624776 |
atgctttgaaaaacaagcatttagttaatgatatgttgaaaatacctgagcgtacatttacagatcctgaccctcaagttcagattgccacacaggt |
47624680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1489 times since January 2019
Visitors: 3452