View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0502_low_8 (Length: 313)

Name: NF0502_low_8
Description: NF0502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0502_low_8
NF0502_low_8
[»] chr4 (1 HSPs)
chr4 (47-313)||(47624806-47625072)


Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 47 - 313
Target Start/End: Original strand, 47624806 - 47625072
Alignment:
47 catgcttgaacagcctgaatcttcgtaccactatctagcaaatccttcatcccattgagtaattttatcttcatatctttgacaagaacctgttgaaaaa 146  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
47624806 catgcttgaacagcctgaatcttcgtaccactatctagcaaatccttcatcccattgagcaattttatcttcatatctttgacaagaacctgttgaaaaa 47624905  T
147 ggagaccagagagcacatgtataaaccattgcatgaaactttatagtacagttatgaaatgtcatggtcatgacatagtttgttttgttttccacattgc 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47624906 ggagaccagagagcacatgtataaaccattgcatgaaactttatagtacagttatgaaatgtcatggtcatgacatagtttgttttgttttccacattgc 47625005  T
247 aataccccaaaaaacgatatttagatcattgtctaccacagcaaaacttgcaggcagcagagttaac 313  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47625006 aataccccaaaaaacgatatttagatcattgtctaccacagcaaaacttgcaggcagcagagttaac 47625072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University