View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0505_low_3 (Length: 300)
Name: NF0505_low_3
Description: NF0505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0505_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 28 - 289
Target Start/End: Original strand, 121214 - 121475
Alignment:
Q |
28 |
gaatggctttccaatattgttgaggaatcgttttcaagtgaggatcttcaaaagatgcaactgatatcgggcatgaaggtaagaaaccaggacgaagaac |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
121214 |
gaatggctttccaatattgttgaggaatcgttttcaagtgaggatcttcaaaagatgcaactgatatcgggcatgaaggtaagaaaccaggacgaagaac |
121313 |
T |
 |
Q |
128 |
cccgcgagctttcccaacccaaccgaaacaatcctatattcaacaaggaagttttggttccagctaaggcccgtagcaagaggactcgtgggcccccttg |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
121314 |
cccgcgagctttcccaacccaaccgaaacaatcctatattcaacaaggaagttttggttccagctaaggcccgtagcaagaggactcgtgggcccccttg |
121413 |
T |
 |
Q |
228 |
cgactggagctcacgtcttcttgttttgtctcaaacaacaccgtcttcttctgagtcagaat |
289 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
121414 |
cgactggagctcacgtcttcttgttttgtctcaaacaacaccgtcttcttctgagtcagaat |
121475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University