View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0505_low_4 (Length: 252)
Name: NF0505_low_4
Description: NF0505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0505_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 22 - 197
Target Start/End: Complemental strand, 4812078 - 4811903
Alignment:
Q |
22 |
tgatcttcagaatttcccctccaaatatcttttcttttattaatcaagattttatattgcctcatgcttaaactatctggtctacaacgatccattactt |
121 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
4812078 |
tgatcttcagaatttcccctccaaatatcttttcttttattaatcaagattttatattgcctcatgcttaaactatctggtctacaacgatccatcactt |
4811979 |
T |
 |
Q |
122 |
caaacattattttttcttattacctgtttcacagatctgaatttgatgcaattaggatataaatttccatccctag |
197 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4811978 |
caaacattattttttcttattacctgtttcacagatctgaatttgatgcaattaggatataaatttccatccctag |
4811903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1425 times since January 2019
Visitors: 3449