View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0505_low_5 (Length: 203)
Name: NF0505_low_5
Description: NF0505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0505_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 53 - 111
Target Start/End: Complemental strand, 2698499 - 2698441
Alignment:
Q |
53 |
cttatgtgtgagtgtttttgtcatagtaaatggtgggtacgtgtgcaattgcttctgtg |
111 |
Q |
|
|
|||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
2698499 |
cttatgtgtgggtgttttcgtcatagtaaatggtgggtacgtgtgcaactgcttctgtg |
2698441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 2698594 - 2698540
Alignment:
Q |
1 |
atttgacagtttgaggttgtgctttggattgtaatgcttgaaagggcggtgtctt |
55 |
Q |
|
|
|||||||||||||||||| ||||||||| |||||||||||||||| ||||||||| |
|
|
T |
2698594 |
atttgacagtttgaggttttgctttggactgtaatgcttgaaaggacggtgtctt |
2698540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University