View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0506_low_9 (Length: 218)
Name: NF0506_low_9
Description: NF0506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0506_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 6e-33; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 30 - 105
Target Start/End: Complemental strand, 8677350 - 8677275
Alignment:
| Q |
30 |
ttattttatctcattttcggatgcaaatgatgtcttttttgtaaactttaattcagacgttcagtagttatcatct |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8677350 |
ttattttatctcattttcggatgcaaatgatgtcttttttgtaaactttaattaagacgttcagtagttatcatct |
8677275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 36 - 105
Target Start/End: Complemental strand, 8643377 - 8643308
Alignment:
| Q |
36 |
tatctcattttcggatgcaaatgatgtcttttttgtaaactttaattcagacgttcagtagttatcatct |
105 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
8643377 |
tatctcattttaggatgcaaatgatgtcttttttgtaaactttaattcagatgttcagtaattatcatct |
8643308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 36 - 105
Target Start/End: Complemental strand, 8635951 - 8635881
Alignment:
| Q |
36 |
tatctcattttcggatgcaaatgatgtctttttt-gtaaactttaattcagacgttcagtagttatcatct |
105 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
8635951 |
tatctcattttaggatgcaaatgatgtctttttttgtaaactttaattaagatgttcagtagttatcatct |
8635881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 37 - 81
Target Start/End: Original strand, 8545365 - 8545409
Alignment:
| Q |
37 |
atctcattttcggatgcaaatgatgtcttttttgtaaactttaat |
81 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8545365 |
atctcattttaggatgcaaatgatgtcttttttgtaaactttaat |
8545409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 81
Target Start/End: Original strand, 9075532 - 9075576
Alignment:
| Q |
37 |
atctcattttcggatgcaaatgatgtcttttttgtaaactttaat |
81 |
Q |
| |
|
||||| |||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
9075532 |
atctcgttttaggatgcaaatgatggcttttttgttaactttaat |
9075576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 37 - 78
Target Start/End: Original strand, 44438680 - 44438721
Alignment:
| Q |
37 |
atctcattttcggatgcaaatgatgtcttttttgtaaacttt |
78 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||| |||||||| |
|
|
| T |
44438680 |
atctcattttaggaggcaaatgatgtcttttttctaaacttt |
44438721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1691 times since January 2019
Visitors: 3461