View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0507_low_10 (Length: 205)

Name: NF0507_low_10
Description: NF0507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0507_low_10
NF0507_low_10
[»] chr7 (1 HSPs)
chr7 (24-132)||(33267846-33267954)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 24 - 132
Target Start/End: Complemental strand, 33267954 - 33267846
Alignment:
24 atcaaggtatctctaccgttggatatagatcgaacaactctaattcttaatttattaattttattttaaattacatatcataatatgagtcgtctgatct 123  Q
    ||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||    
33267954 atcaaggtatctctaccgttgaataaagatcgaacaactctaattcttactttattaattttactttaaagtacatatcataatatgagtcgtctgatct 33267855  T
124 tcatctcac 132  Q
    |||||||||    
33267854 tcatctcac 33267846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1673 times since January 2019
Visitors: 3461