View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0507_low_6 (Length: 312)
Name: NF0507_low_6
Description: NF0507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0507_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 72 - 226
Target Start/End: Complemental strand, 2556338 - 2556184
Alignment:
Q |
72 |
agagacctaaccaattttaagaactcattcagtgccgaaaacgattcaacgatgcttaaatcgagtccttcaactcacattcgagctccgaaatcatcga |
171 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2556338 |
agagacctaaccaattttaagaactcattcagtgccggaaacgattcaacgatgcttaaatcgagtccttcaactcacattcgagctccgaaatcatcga |
2556239 |
T |
 |
Q |
172 |
catgcttgcaaaatacacctactacgatgaaaacaatgataatgaggttgagggg |
226 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2556238 |
catgcttccaaaatacacctactacgatgaaaacaatgataatgaggttgagggg |
2556184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University