View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0507_low_7 (Length: 309)
Name: NF0507_low_7
Description: NF0507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0507_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 7e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 89 - 277
Target Start/End: Complemental strand, 14288552 - 14288364
Alignment:
| Q |
89 |
gaagataccgtcgacaaattcagaaatgccggcattgaagaggcggttgatatcggtttcggagagggtagagatgaggcgagttatctcggagggggag |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
14288552 |
gaagataccgtcgacaaattcagaaatgccggcattgaagaggcggttgatatcggtttcggagaggttagagatgaggcgagttatctcggaggtagag |
14288453 |
T |
 |
| Q |
189 |
aggcgagctatctcgacttgagagagggaagggggtttagttgcaatgtagttggcgagaaagcggaagagcggctgggctatatcgtc |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
14288452 |
aggcgagctatctcgacttgagagagggaagtggttttagttgcaatgtagttggcgagaaagcggaagagcgactgagctatatcgtc |
14288364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 158 - 247
Target Start/End: Complemental strand, 14281319 - 14281230
Alignment:
| Q |
158 |
agagatgaggcgagttatctcggagggggagaggcgagctatctcgacttgagagagggaagggggtttagttgcaatgtagttggcgag |
247 |
Q |
| |
|
|||||||||| | ||||||||| || || |||||||||||||||||||| | |||||||| || ||| || ||||||||||||||||| |
|
|
| T |
14281319 |
agagatgaggttatttatctcggcggtggtgaggcgagctatctcgacttcggtgagggaagaggtttttgtagcaatgtagttggcgag |
14281230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University