View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0508_high_2 (Length: 251)
Name: NF0508_high_2
Description: NF0508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0508_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 24606723 - 24606502
Alignment:
| Q |
1 |
tgaattggtgagaaattgctgtcaaatccttacatat--tactgtatatttttatagtatggaaaacttccttctaagttgtatggtatttggctgatag |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24606723 |
tgaattggtgagaaattgctgtcaaatccttacatatattactgtatatttttatagtatagaaaacttccttctaagttgcatggtatttggctgatag |
24606624 |
T |
 |
| Q |
99 |
acactaggttgtcaattttcatcgcacttttcatggcaagtagaagctcacgagttgatttttgggaagtcaagaatccctttgcatggtatg--tatct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24606623 |
acactaggttgtcaattttcatcgcacttttcatggcaagtagaagctcacgagggtatttttgggaagtcaagaatccctttgcatggtatgtatatct |
24606524 |
T |
 |
| Q |
197 |
ttcccaccgtcccttgtagata |
218 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
24606523 |
ttcccaccgtcccttgtagata |
24606502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University