View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0508_low_4 (Length: 228)
Name: NF0508_low_4
Description: NF0508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0508_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 7 - 183
Target Start/End: Complemental strand, 18677323 - 18677141
Alignment:
| Q |
7 |
attggtttggttttagagattcatgcgttatttttagatgtagtttgttgaatgggttaata-------acaaaacactatgatcatttaaatttgaggg |
99 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
18677323 |
attggtttggttttagagattcatgcattatttttagatgtagtttgttgaatgggttaatacttaataacaaaatactatgatcatttaaatttgaggg |
18677224 |
T |
|
| Q |
100 |
actatgatcatttaaattttgtttgcaactaaagatctatctttaaaagtttgagaaaatgatggacggttaattttattttat |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18677223 |
actatgatcatttaaattttgtttgcaactaaagatttatcttt-aaagtttgagaaaatgatggacggtttattttattttat |
18677141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1341 times since January 2019
Visitors: 3441