View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0509_low_10 (Length: 228)
Name: NF0509_low_10
Description: NF0509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0509_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 11 - 214
Target Start/End: Complemental strand, 33034353 - 33034150
Alignment:
Q |
11 |
ttactttacaaaaactgctgattcctgtccaatgtccatttgcctctttttgaacttggagagtatctgatgcaaaatattgcaaagctgcagaaaaaat |
110 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33034353 |
ttactttacaaaaactgctgattcctgtccaatgtccatttgcctctttttgaacttggagagtatctgatgcaaaatattgcaaagctgcagaaaaaat |
33034254 |
T |
 |
Q |
111 |
atcatttcactttgaggttgatcaaacacatggatgacctgcaaaatcataagtatgaaaataatgcttaaaagcattggaaaatacataactagttgat |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33034253 |
atcatttcactttgaggttgatcaaacacatggatgacctgcaaaatcataagtatgaaaataatgcttaaaagcattggaaaatacataactagttgat |
33034154 |
T |
 |
Q |
211 |
gatg |
214 |
Q |
|
|
|||| |
|
|
T |
33034153 |
gatg |
33034150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University