View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0509_low_2 (Length: 346)
Name: NF0509_low_2
Description: NF0509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0509_low_2 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 149 - 346
Target Start/End: Complemental strand, 3904725 - 3904528
Alignment:
| Q |
149 |
gctggtttgattatttgacgtgattgtttaaactctttataattgatatctgcagctgctagaacatctgattcgacagttaagcaaagtgtacttcaag |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3904725 |
gctggtttgattatttgacgtgattgtttaaactctttataattgatatctgcagctgctagaacatctgattcgacagttaagcaaagtgtacttcaag |
3904626 |
T |
|
| Q |
249 |
gtaaaggtatctcttcgccccttggtagagctagcagcaaggctattccaactatagctaaccccctaatacctctatcatctcctctttggagccta |
346 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3904625 |
gtaaaggtatctcttcgcctcttggtagagctagcagcaaggctactccaactatagctaaccccctaatacctctatcatctcctctttggagccta |
3904528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 14 - 114
Target Start/End: Complemental strand, 3904860 - 3904760
Alignment:
| Q |
14 |
gaacctgtgggagaatgtctggcgtgtctgcatggaaaggcagcgtagtcaaaaatctcatcctaataccccagaaacacctctgcagtcaagatctggt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3904860 |
gaacctgtgggagaatgtctggcgtgtctgcatggaaaggcagcgtagtcaaaaatctcatcctaataccccagaaacacctctgcagtcaagatctggt |
3904761 |
T |
|
| Q |
114 |
a |
114 |
Q |
| |
|
| |
|
|
| T |
3904760 |
a |
3904760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 298 times since January 2019
Visitors: 3649