View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0510_low_2 (Length: 345)
Name: NF0510_low_2
Description: NF0510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0510_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 9 - 297
Target Start/End: Original strand, 46286736 - 46287025
Alignment:
Q |
9 |
aatttaatttcaaaatctttaaattt-agatatggtagatacctaaaaaatgataaaatgagatttaaagccaaaacggcaaacaaagggcaaataggag |
107 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46286736 |
aatttaatttcaaaatctttaaattttagatatggtaaatacctaaaaaatgataaaatgagatttaaagccaaaacggcaaacaaagggcaaataggag |
46286835 |
T |
 |
Q |
108 |
gaagaagattaatgggtaaaggaatttggtatcaatagttttaggattttaatgtcgagggttgggtattgtgtttgagactatcaaggagttcttttgc |
207 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46286836 |
gaagaagattaatgggtaaaggaatttggtatcgatagttttaggattttaatgtcgagggttgggtattgtgtttgagactatcaaggagttcttttgc |
46286935 |
T |
 |
Q |
208 |
cacgagaacatcccgggctccaaaccggatatacacaaatgaaggtgtgaagttgttgctctcttacaagatattcatgggatgctttct |
297 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46286936 |
cacgagaacatcccgggctccaaaccggatatacacaaataaaggtgtgaagttgttgctctcttacaagatattcatgggatgctttct |
46287025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 8 - 51
Target Start/End: Complemental strand, 10567566 - 10567522
Alignment:
Q |
8 |
aaatttaatttcaaaatctttaaa-tttagatatggtagatacct |
51 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
10567566 |
aaatttaatttcaaaatctttaaattttagatatggtagatacct |
10567522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 10568350 - 10568394
Alignment:
Q |
8 |
aaatttaatttcaaaatctttaaa-tttagatatggtagatacct |
51 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
10568350 |
aaatttaatttcaaaatctttaaattttagatatggtagatacct |
10568394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University