View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0510_low_4 (Length: 271)
Name: NF0510_low_4
Description: NF0510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0510_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 223
Target Start/End: Original strand, 46286819 - 46287025
Alignment:
Q |
17 |
caaagggcaaataggaggaagaagattaatgggtaaaggaatttggtatcaatagttttaggattttaatgtcgagggttgggtattgtgtttgagacta |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46286819 |
caaagggcaaataggaggaagaagattaatgggtaaaggaatttggtatcgatagttttaggattttaatgtcgagggttgggtattgtgtttgagacta |
46286918 |
T |
 |
Q |
117 |
tcaaggagttcttttgccacgagaacatcccgggctccaaaccggatatacacaaatgaaggtgtgaagttgttgctctcttacaagatattcatgggat |
216 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46286919 |
tcaaggagttcttttgccacgagaacatcccgggctccaaaccggatatacacaaataaaggtgtgaagttgttgctctcttacaagatattcatgggat |
46287018 |
T |
 |
Q |
217 |
gctttct |
223 |
Q |
|
|
||||||| |
|
|
T |
46287019 |
gctttct |
46287025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University