View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0511_high_1 (Length: 284)
Name: NF0511_high_1
Description: NF0511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0511_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 63 - 241
Target Start/End: Original strand, 2089796 - 2089974
Alignment:
| Q |
63 |
ctattcacttttcgatgaattgtgtgccatgtataagagctaacacccattgtaacacattcaacgagttcaaaacaaacaaaatttacacctctaaatg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2089796 |
ctattcacttttcgatgaattgtgtgccatgtataagagctaacacccattgtaacacattcaacgagttcaaaacaaacaaaatttacacctctaaatg |
2089895 |
T |
 |
| Q |
163 |
agaccaataagatcttgccatcttttagatttatctccctttgacaattatcaaaaacacaatcaggatgaagtattat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2089896 |
agaccaataagatcttgccatcttttagatttatctccctttgacaattatcaaaaacacaatcaggatgaagtgttat |
2089974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University