View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0512_low_5 (Length: 281)
Name: NF0512_low_5
Description: NF0512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0512_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 63 - 239
Target Start/End: Original strand, 39110372 - 39110548
Alignment:
Q |
63 |
cggtccagaagtgaactttggacaatgtttagttctgcacatcaaatgggaagttgtagaatgggtaagaatgaagaagagggtgcagttgatgagaatg |
162 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39110372 |
cggtccagaagtgaactttggacaatgtttagttctgcacatcaaatgggaagttgtagaatgggtaagaatgaagaagagggtgcagttgatgagaatg |
39110471 |
T |
 |
Q |
163 |
gagaaagttgggaagcaaaagggttgcatgtgtgtgatggaagtgttttgcctagtgcagttggtgttaaccctatg |
239 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39110472 |
gagaaagttgggaagcaaaagggttgtatgtgtgtgatggaagtgttttgcctagtgcagttggtgttaaccctatg |
39110548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 7e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 95 - 241
Target Start/End: Original strand, 31321749 - 31321895
Alignment:
Q |
95 |
ttctgcacatcaaatgggaagttgtagaatgggtaagaatgaagaagagggtgcagttgatgagaatggagaaagttgggaagcaaaagggttgcatgtg |
194 |
Q |
|
|
|||||| ||||||||||| |||||||||||||| ||||||| | || ||||| |||||||| ||||| || ||||||||||| |||||||| ||| |
|
|
T |
31321749 |
ttctgctcatcaaatggggagttgtagaatgggagtgaatgaaaaggaaggtgctgttgatgaaaatggtgagagttgggaagctgaagggttgtttgtt |
31321848 |
T |
 |
Q |
195 |
tgtgatggaagtgttttgcctagtgcagttggtgttaaccctatgat |
241 |
Q |
|
|
||||||| |||||| | || | ||| ||||||||||| |||||||| |
|
|
T |
31321849 |
tgtgatgctagtgttcttccaactgctgttggtgttaatcctatgat |
31321895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 95 - 241
Target Start/End: Original strand, 31334002 - 31334148
Alignment:
Q |
95 |
ttctgcacatcaaatgggaagttgtagaatgggtaagaatgaagaagagggtgcagttgatgagaatggagaaagttgggaagcaaaagggttgcatgtg |
194 |
Q |
|
|
|||||| ||||||||||| |||||||||||||| ||||||| | || ||||| |||||||| ||||| || ||||||||||| |||||||| ||| |
|
|
T |
31334002 |
ttctgctcatcaaatggggagttgtagaatgggagtgaatgaaaaggaaggtgctgttgatgaaaatggtgagagttgggaagctgaagggttgtttgtt |
31334101 |
T |
 |
Q |
195 |
tgtgatggaagtgttttgcctagtgcagttggtgttaaccctatgat |
241 |
Q |
|
|
||||||| |||||| | || | ||| ||||||||||| |||||||| |
|
|
T |
31334102 |
tgtgatgctagtgttcttccaactgctgttggtgttaatcctatgat |
31334148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1238 times since January 2019
Visitors: 3642