View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0512_low_6 (Length: 210)

Name: NF0512_low_6
Description: NF0512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0512_low_6
NF0512_low_6
[»] chr8 (1 HSPs)
chr8 (1-72)||(28380073-28380144)


Alignment Details
Target: chr8 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 28380073 - 28380144
Alignment:
1 tcttcctctttatagcttttatattgtgtttttctttttatgtgtcagagaaaacattaaggaaaacaaagg 72  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
28380073 tcttcctctttatagcttttatattgtgtttttcttttcatgtgtcagagaaaacattaaggaaaacaaagg 28380144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University