View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0512_low_6 (Length: 210)
Name: NF0512_low_6
Description: NF0512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0512_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 28380073 - 28380144
Alignment:
Q |
1 |
tcttcctctttatagcttttatattgtgtttttctttttatgtgtcagagaaaacattaaggaaaacaaagg |
72 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
28380073 |
tcttcctctttatagcttttatattgtgtttttcttttcatgtgtcagagaaaacattaaggaaaacaaagg |
28380144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 48 times since January 2019
Visitors: 3646