View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0513_high_2 (Length: 223)
Name: NF0513_high_2
Description: NF0513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0513_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 41135533 - 41135386
Alignment:
| Q |
1 |
tttcttcctactatacttaccactgcgtttgagcctcgaacggtagtgccgctgagcaaactcaacactttgcatttcaatctctttttctgactccttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41135533 |
tttcttcctactatacttaccactgcgtttgagcttcgaacggtagtgctgctgagcaaactcaacactttgcatttcaatctctttttctgactccttc |
41135434 |
T |
 |
| Q |
101 |
cacaaaactggttctttctcctccctactactttcatttctttcatct |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41135433 |
cacaaaactggttctttctcctccctactactttcatttctttcatct |
41135386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University