View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0513_low_3 (Length: 223)

Name: NF0513_low_3
Description: NF0513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0513_low_3
NF0513_low_3
[»] chr8 (1 HSPs)
chr8 (1-148)||(41135386-41135533)


Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 41135533 - 41135386
Alignment:
1 tttcttcctactatacttaccactgcgtttgagcctcgaacggtagtgccgctgagcaaactcaacactttgcatttcaatctctttttctgactccttc 100  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
41135533 tttcttcctactatacttaccactgcgtttgagcttcgaacggtagtgctgctgagcaaactcaacactttgcatttcaatctctttttctgactccttc 41135434  T
101 cacaaaactggttctttctcctccctactactttcatttctttcatct 148  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
41135433 cacaaaactggttctttctcctccctactactttcatttctttcatct 41135386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1247 times since January 2019
Visitors: 3642