View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0514_high_1 (Length: 292)

Name: NF0514_high_1
Description: NF0514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0514_high_1
NF0514_high_1
[»] chr1 (1 HSPs)
chr1 (54-242)||(2866735-2866923)


Alignment Details
Target: chr1 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 54 - 242
Target Start/End: Original strand, 2866735 - 2866923
Alignment:
54 gttgcttctgcttcatttctttattagctgcagaattcaacatagtatctaccacttcaaacctaccaacacttcctcttgatgatgttgatgttctatg 153  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2866735 gttgcttctgcttcatttctttattagctgcagaattcatcatagtatctaccacttcaaacctaccaacacttcctcttgatgatgttgatgttctatg 2866834  T
154 aaaatcagctatacctagttttgctatcccaggttgttgatccataaagattcttgagtttgaccaaccatgatgatgatgatgtccat 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
2866835 aaaatcagctatacctagttttgctatcccaggttgttgatccataaagattcttgagtttgaccaaccatgatgatgatgatgcccat 2866923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1290 times since January 2019
Visitors: 3643