View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0514_low_1 (Length: 292)
Name: NF0514_low_1
Description: NF0514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0514_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 54 - 242
Target Start/End: Original strand, 2866735 - 2866923
Alignment:
| Q |
54 |
gttgcttctgcttcatttctttattagctgcagaattcaacatagtatctaccacttcaaacctaccaacacttcctcttgatgatgttgatgttctatg |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2866735 |
gttgcttctgcttcatttctttattagctgcagaattcatcatagtatctaccacttcaaacctaccaacacttcctcttgatgatgttgatgttctatg |
2866834 |
T |
 |
| Q |
154 |
aaaatcagctatacctagttttgctatcccaggttgttgatccataaagattcttgagtttgaccaaccatgatgatgatgatgtccat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2866835 |
aaaatcagctatacctagttttgctatcccaggttgttgatccataaagattcttgagtttgaccaaccatgatgatgatgatgcccat |
2866923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University