View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0515_low_6 (Length: 250)
Name: NF0515_low_6
Description: NF0515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0515_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 38932565 - 38932345
Alignment:
Q |
1 |
tcggtaatttgtacaaccgatccagaaatgtgttaaagtaatagtgaaattatgtgtgataataaaggtggtgttcgctgatcagaacataaaattatgt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38932565 |
tcggtaatttgtacaaccgatccagaaatgtgttaaagtaatagtgaaattatgtgtgataataaaggtggtgttcgctgatcagaacataaaattatgt |
38932466 |
T |
 |
Q |
101 |
gttgggtgcaggtataagaacaaaacaggagttgcattgttgtgcaaggaaagcagccattaaccaatttacaaacagcacaaaactttctaaagttcat |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38932465 |
gttgggtgcaggtataagaacaaaacaggagttgcattgttgtgcaaggaaagcagccattaaccaatttacaaacagcacaaaactttctaaagttcat |
38932366 |
T |
 |
Q |
201 |
acggctccaaacagcacttaa |
221 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
38932365 |
acggctccaaacagcacttaa |
38932345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University